Strand settings

Each adapter is defined as either Plus or Minus. Note that all the definitions (see here and here) regarding 3' end and 5' end also apply to the minus strand (i.e. selecting the Minus strand is equivalent to reverse complementing all the reads). The adapter in this case should be defined as you would see it on the plus strand of the reverse complemented read. The example below (23.7) shows a few examples of an adapter defined on the minus strand. It shows hits for an adapter sequence defined as CTGCTGTACGGCCAAGGCG, searching on the minus strand.
Figure 23.7: An adapter defined as CTGCTGTACGGCCAAGGCG searching on the minus strand. Red is the part that is removed and green is the retained part. The retained part is 3' of the match on the minus strand, just like matches on the plus strand.

     ACCGAGAAA CGCCTTGGCCGTACAGCAG
a)           |||||||||||||||||||    19 matches = 19
                                



     ACCGATAAA CGCCTTGGCCGTACAGCAGATGCC
b)           ||||||||| |||||||||    18 matches - 2 mismatches = 16
                                


You can see that if you reverse complemented the adapter you would find the hit on the plus strand, but then you would have trimmed the wrong end of the read. So it is important to define the adapter as it is, without reverse complementing.