Browse the manual

Introduction to CLC Cancer Research Workbench
- Contact information
- System requirements
  - Limitations on maximum number of cores
- Workbench Licenses
- About CLC Workbenches
  - New program feature request
  - Getting help
- When the program is installed: Getting started
  - Import of example data
- Plugins
- Network configuration
User interface
- View Area
- Zoom and selection in View Area
- Toolbox and Status Bar
- Workspace
- List of shortcuts
Data organization and management
- Navigation Area
- Customized attributes on data locations
- Filling in values
- Sequence web info
User preferences and settings
- General preferences
- Default view preferences
  - Number formatting in tables
  - Import and export Side Panel settings
- Data preferences
- Advanced preferences
  - Default data location
- Export/import of preferences
  - The different options for export and import
- View settings for the Side Panel
  - Saving, removing and applying saved settings
Printing
- Selecting which part of the view to print
- Page setup
  - Header and footer
- Print preview
Import/export of data and graphics
- Standard import
- Import tracks
- Import high-throughput sequencing data
- Import Primer Pairs
- Data export
- Export graphics to files
- Export graph data points to a file
- Copy/paste view output
History log
- Element history
  - Sharing data with history
Batching and result handling
- Batch processing
- How to handle results of analyses
  - Table outputs
  - Batch log
- Working with tables
  - Filtering tables
Viewing and editing sequences
- View sequence
- Circular DNA
  - Using split views to see details of the circular molecule
  - Mark molecule as circular and specify starting point
- Working with annotations
- Element information
- View as text
- Sequence Lists
Viewing structures
- Importing molecule structure files
- Viewing molecular structures in 3D
  - Moving and rotating
  - Troubleshooting 3D graphics errors
- Customizing the visualization
  - Visualization styles and colors
  - Project settings
- Snapshots of the molecule visualization
- Tools for linking sequence and structure
- Protein structure alignment
Getting started
- Reference data
- Create new folder
- Import data
  - How to import data
Preparing Raw Data
- Prepare sequencing data - all application types
- Analysis of sequencing data
Whole genome sequencing (WGS)
- Automatic analysis of sequencing data (WGS)
- Identify Variants (WGS)
  - How to run the 'Identify Variants' ready-to-use workflow
  - Output from the Identify Variants workflow
- Annotate Variants (WGS)
- Filter Somatic Variants (WGS)
- Identify Somatic Variants from Tumor Normal Pair (WGS)
- Identify Known Variants in One Sample (WGS)
Whole exome sequencing (WES)
- Automatic analysis of sequencing data (WES)
- Identify Variants (WES)
- Annotate Variants (WES)
- Filter Somatic Variants (WES)
- Identify Somatic Variants from Tumor Normal Pair (WES)
  - Import your targeted regions
  - How to run the 'Identify Somatic Variants from Tumor Normal Pair' ready-to-use workflow
- Identify Known Variants in One Sample (WES)
- Identify and Annotate Variants (WES)
Targeted amplicon sequencing (TAS)
- Automatic analysis of sequencing data (TAS)
- Identify Variants (TAS)
- Annotate Variants (TAS)
- Filter Somatic Variants (TAS)
- Identify Somatic Variants from Tumor Normal Pair (TAS)
  - Import your targeted regions
  - How to run the 'Identify Somatic Variants from Tumor Normal Pair' ready-to-use workflow
- Identify Known Variants in One Sample (TAS)
- Identify and Annotate Variants (TAS)
Whole Transcriptome Sequencing (WTS)
- Automatic analysis of RNA-seq data
- Analysis of multiple samples
- Annotate Variants (WTS)
- Compare variants in DNA and RNA
- Identify Candidate Variants and Genes from Tumor Normal Pair
- Identify variants and add expression values
- Identify and Annotate Differentially Expressed Genes and Pathways
Using data from other workbenches
- Open outputs from other workbenches
Genome browser tools
- Create new genome browser view
- Genome browser view
- Creating graph tracks
Quality control tools
- QC for Target Sequencing
- QC for Sequencing Reads
- QC for Read Mapping
  - Running the 'QC for Read Mapping' tool
  - Summary mapping report
Preparing raw data tools
- Merge overlapping pairs
  - Using quality scores when merging
  - Report of merged pairs
- Trim Sequences
- Demultiplex reads
Resequencing analysis tools
- Identify Known Mutations from Sample Mappings
  - Input and Parameters
  - Output from the 'Identify Known Mutations from Sample Mappings' tool
  - How to run the 'Identify Known Mutations from Sample Mappings' tool
- Trim primers of mapped reads
- Extract reads based on overlap
- Map Reads to Reference
  - Selecting reads and reference
  - Including or excluding regions (masking)
  - Mapping parameters
  - Gap placement
  - Computational requirements
  - Reference Caching
- Mapping output options
- Color space
  - Sequencing
  - Error modes
  - Mapping in color space
  - Viewing color space information
- Mapping result
  - View settings in the Side Panel
- Local realignment
  - Method
  - Realignment of unaligned ends
  - Guided Realignment
  - Multi-pass local realignment
  - Known Limitations
  - Computational Requirements
  - How to run the Local Realignment tool
- Merge mapping results
- Remove duplicate mapped reads
  - Algorithm details and parameters
  - Running the duplicate reads removal
- Coverage analysis
  - Running the Coverage analysis tool
- Variant Detectors - overview
  - Differences among the variants called by the three variant callers
  - How the variant detectors work
- Basic Variant Detection
- Fixed Ploidy Variant Detection
  - Ploidy and sensitivity
- Low Frequency Variant Detection
- Variant Detectors - error model estimation
- Variant Detectors - filters
  - General filters
  - Noise filters
- Variant Detectors - the outputs
  - The variant track output
  - The annotated table output
  - The report
- The Fixed Ploidy and Low Frequency variant callers: detailed descriptions
  - The Fixed Ploidy Variant caller: Models and methods
  - The Low Frequency Variant caller: Models and methods
- InDels and Structural Variants
  - How to run the InDels and Structural Variants tool
  - The Structural Variants and InDels output
  - The InDels and Structural Variants detection algorithm
  - The InDels and Structural Variants detection algorithm - Step 1: Creating Left- and Right breakpoint signatures
  - The InDels and Structural Variants detection algorithm - Step 2: Creating Structural variant signatures
  - Theoretically expected structural variant signatures
  - How sequence complexity is calculated
- Variant data
  - Variant tracks
  - The annotated variant table
  - Variant types
- Detailed information about overlapping paired reads
Add information to variants tools
- Add information from variant databases
- Add conservation scores
- Add exon number
- Add flanking sequence
- Add fold changes
- Add information about amino acid changes
- Add information from genomic regions
- Add information from overlapping genes
- Link Variants to 3D Protein Structure
- Download 3D Protein Structure Database
- From databases
Remove variants tools
- Remove variants found in external database
- Remove variants not found in external database
- Remove false positives
- Remove Germline Variants
- Remove reference variants
- Remove variants inside genome regions
- Remove variants outside genome regions
- Remove variants outside targeted regions
- From databases
Add information to genes tool
- Add information from overlapping variants
Compare samples tools
- Compare shared variants within a group of samples
- Identify Enriched Variants in Case vs Control Group
- Trio analysis
Identify candidate variants tools
- Create Filter Criteria
- Identify candidate variants
- Remove information from variants
- Identify variants with effect on splicing
Identify candidate genes tools
- Identify differentially expressed gene groups and pathways
- Identify highly mutated gene groups and pathways
- Identify mutated genes
- Select genes by name
Transcriptomics tools
- RNA-Seq analysis
- Small RNA analysis
- Experimental design
- Working with tracks and experiments
- Transformation and normalization
- Quality control
- Statistical analysis - identifying differential expression
- Feature clustering
  - Hierarchical clustering of features
  - K-means/medoids clustering
- Annotation tests
  - Hypergeometric tests on annotations
  - Gene set enrichment analysis
- General plots
Helper tools
- Extract sequences
Cloning and cutting
- Molecular cloning
- Gateway cloning
- Restriction site analysis
  - Dynamic restriction sites
  - Restriction site analysis from the Toolbox
- Gel electrophoresis
- Restriction enzyme lists
  - Create enzyme list
  - View and modify enzyme list
Sequencing Data Analysis
- Importing and viewing trace data
  - Scaling traces
  - Trace settings in the Side Panel
- Trim sequences
  - Trimming using the Trim tool
  - Manual trimming
- Assemble sequences
- Sort sequences by name
- Assemble sequences to reference
- Add sequences to an existing contig
- View and edit read mappings
- Reassemble contig
- Secondary peak calling
Primers
- Primer design - an introduction
  - General concept
  - Scoring primers
- Setting parameters for primers and probes
  - Primer Parameters
- Graphical display of primer information
  - Compact information mode
  - Detailed information mode
- Output from primer design
- Standard PCR
  - User input
  - Standard PCR output table
- Nested PCR
  - Nested PCR output table
- TaqMan
  - TaqMan output table
- Sequencing primers
  - Sequencing primers output table
- Alignment-based primer and probe design
- Analyze primer properties
- Find binding sites and create fragments
  - Binding parameters
  - Results - binding sites and fragments
- Order primers
Epigenomics
- ChIP-Seq Analysis
- Annotate with nearby gene information
Workflows
- Creating a workflow
- Distributing and installing workflows
- Executing a workflow
- Open copy of ready-to-use workflow
Legacy tools
- Quality-based variant detection
- Probabilistic variant detection
Appendix
- Use of multi-core computers
- Reference data overview
- Proteolytic cleavage enzymes
- Restriction enzymes database configuration
- Technical information about modifying Gateway cloning sites
- IUPAC codes for amino acids
- IUPAC codes for nucleotides
- Formats for import and export
  - List of bioinformatic data formats
  - List of graphics data formats
- SAM/BAM export format specification
  - Flags
- Gene expression annotation files and microarray data formats
- Translation Tables
- Matrices for alignment calculation
Bibliography

Import using copy/paste of text

If you have e.g. a text file or a browser displaying a sequence in one of the formats that can be imported by CLC Cancer Research Workbench, there is a very easy way to get this sequence into the Navigation Area:

Copy the text from the text file or browser | Select a folder in the Navigation Area | Paste ()

This will create a new sequence based on the text copied. This operation is equivalent to saving the text in a text file and importing it into the CLC Cancer Research Workbench.

If the sequence is not formatted, i.e. if you just have a text like this: "ATGACGAATAGGAGTTCTAGCTA" you can also paste this into the Navigation Area.

Note! Make sure you copy all the relevant text - otherwise CLC Cancer Research Workbench might not be able to interpret the text.