The clc_mapping_table Program
The clc_mapping_table program takes a single cas file as input and prints assembly information for each read. By default, clc_mapping_table makes a table with one read per row. The columns are:
- Read number (starting from 0).
- Read name (enable using the `-n' option).
- Read length.
- Read position for alignment start.
- Read position for alignment end.
- Reference sequence number (starting from 0).
- Reference position for alignment start.
- Reference position for alignment end.
- Whether the read is reversed (0 = no, 1 = yes).
- Number of optimal locations for the read.
- Alignment score (enable using the `-s' option).
Here is part of an example output using both the `-n' and the `-s' option:
208 SLXA-EAS1_89:1:1:622:715/1 35 0 35 0 89385 89420 0 1 35 209 SLXA-EAS1_89:1:1:622:715/2 35 0 35 0 89577 89612 1 1 35 210 SLXA-EAS1_89:1:1:201:524/1 35 0 32 0 4829 4861 0 1 29 211 SLXA-EAS1_89:1:1:201:524/2 -1 -1 -1 -1 -1 -1 -1 -1 -1 212 SLXA-EAS1_89:1:1:662:721/1 35 0 35 0 38254 38289 1 1 35 213 SLXA-EAS1_89:1:1:662:721/2 35 0 35 0 38088 38123 0 1 32 214 SLXA-EAS1_89:1:1:492:826/1 35 0 35 0 81872 81907 1 1 35 215 SLXA-EAS1_89:1:1:492:826/2 35 0 35 0 81685 81720 0 1 35 |
As the read names indicate, the data are from a paired experiment. Read 211 does not match at all and only the first 32 out of the 35 positions in read 210 matches. The score for this read is 29, indicating that a mismatch is also present (31 - 2 = 29). Read 213 also has a mismatch while the rest of the sequences match perfectly. We can also see that the pairs are located close together and on opposite strands.
Use the `-a' option to get a very detailed output (`-n' and `-s' are without effect here):
SLXA-EAS1_89:1:1:622:715/1 has 1 match with a score of 35: 89385 TTGCTGTGGAAAATAGTGAGTCATTTTAAAACGGT 89419 coli ||||||||||||||||||||||||||||||||||| TTGCTGTGGAAAATAGTGAGTCATTTTAAAACGGT read SLXA-EAS1_89:1:1:622:715/2 has 1 match with a score of 35: 89577 AAACTCCTTTCAGTGGGAAATTGTGGGGCAAAGTG 89611 coli ||||||||||||||||||||||||||||||||||| AAACTCCTTTCAGTGGGAAATTGTGGGGCAAAGTG reverse read SLXA-EAS1_89:1:1:201:524/1 has 1 match with a score of 29: 4829 ATCCAGGCGAATATGGCTTGTTCCTCGGCACC 4860 coli ||||||||||||||||||| |||||||||||| ATCCAGGCGAATATGGCTTTTTCCTCGGCACCCCG read SLXA-EAS1_89:1:1:201:524/2 has 0 matches SLXA-EAS1_89:1:1:662:721/1 has 1 match with a score of 35: 38254 AGGGCATTCGATACGGTGGATAAGCTGAGTGCCTT 38288 coli ||||||||||||||||||||||||||||||||||| AGGGCATTCGATACGGTGGATAAGCTGAGTGCCTT reverse read SLXA-EAS1_89:1:1:662:721/2 has 1 match with a score of 32: 38088 ACTGAGTGATTGATTCGCGAGCCACATACTGTGGA 38122 coli |||||||||||||||||||||||||||||| |||| ACTGAGTGATTGATTCGCGAGCCACATACTCTGGA read SLXA-EAS1_89:1:1:492:826/1 has 1 match with a score of 35: 81872 GCATCCAGCACTTTCAGCGCCTGGGTCATCACTTC 81906 coli ||||||||||||||||||||||||||||||||||| GCATCCAGCACTTTCAGCGCCTGGGTCATCACTTC reverse read SLXA-EAS1_89:1:1:492:826/2 has 1 match with a score of 35: 81685 TTCTGGTTGCTGGTCTGGTGGTAAATGTTCCCACT 81719 coli ||||||||||||||||||||||||||||||||||| TTCTGGTTGCTGGTCTGGTGGTAAATGTTCCCACT readNote! The positions in the standard output assumes the reference sequence starts at 0. However, the `-a' option assumes that the reference starts at 1. This is due to the fact that the `-a' option is intended to produce human-readable output whereas the standard option is intended to be used by computer programs.
If multiple hit positions are recorded in the cas file (using the -t option when running the assembly), running the assembly_ table with the `-m', the output looks like this:
480 35 0 35 0 19625 19660 0 1 481 35 0 35 0 19815 19850 1 1 482 35 0 35 0 2512501 2512536 1 3 - 35 0 35 0 607436 607471 1 3 - 35 0 35 0 15593 15628 1 3 483 35 0 35 0 2512321 2512356 0 3 - 35 0 35 0 607256 607291 0 3 - 35 0 35 0 15413 15448 0 3 484 35 0 35 0 14374 14409 1 1 485 35 0 35 0 14194 14229 0 1 |
Reads 482 and 483 map in three places and they are all printed. The order is random, which has the advantage that using the first match (according to output order) is the same as using a random match. For paired data (like these), the matches are in the same order for two paired reads. So the first match for 482 belongs with the first match for 483, etc.
For alignment output in clc_mapping_table with "-m", it looks like this:
SLXA-EAS1_89:1:1:980:945/1 has 1 paired match with a score of 35: (alignment 1) 19626 AGCTCCCCCAAAGTTAAGGTGGGGGAGATAGATTA 19660 coli ||||||||||||||||||||||||||||||||||| AGCTCCCCCAAAGTTAAGGTGGGGGAGATAGATTA read SLXA-EAS1_89:1:1:980:945/2 has 1 paired match with a score of 35: (alignment 1) 19816 GATAGTGTTTTATGTTCAGATAATGCCCGATGACT 19850 coli ||||||||||||||||||||||||||||||||||| GATAGTGTTTTATGTTCAGATAATGCCCGATGACT reverse read SLXA-EAS1_89:1:1:307:821/1 has 3 paired matches with a score of 35: (alignment 1) 2512502 CGGCCCCGGGGGGATGTCATTACGTGAAGTCACTG 2512536 coli ||||||||||||||||||||||||||||||||||| CGGCCCCGGGGGGATGTCATTACGTGAAGTCACTG reverse read SLXA-EAS1_89:1:1:307:821/1 has 3 paired matches with a score of 35: (alignment 2) 607437 CGGCCCCGGGGGGATGTCATTACGTGAAGTCACTG 607471 coli ||||||||||||||||||||||||||||||||||| CGGCCCCGGGGGGATGTCATTACGTGAAGTCACTG reverse read SLXA-EAS1_89:1:1:307:821/1 has 3 paired matches with a score of 35: (alignment 3) 15594 CGGCCCCGGGGGGATGTCATTACGTGAAGTCACTG 15628 coli ||||||||||||||||||||||||||||||||||| CGGCCCCGGGGGGATGTCATTACGTGAAGTCACTG reverse read SLXA-EAS1_89:1:1:307:821/2 has 3 paired matches with a score of 35: (alignment 1) 2512322 GGTATTACGCCTGATATGATTTAACGTGCCGATGA 2512356 coli ||||||||||||||||||||||||||||||||||| GGTATTACGCCTGATATGATTTAACGTGCCGATGA read
Options for the clc_mapping_table are described in Options for All Programs.