Options for clc_adapter_trim

usage: clc_adapter_trim [options]
  Trims adapter sequences away in a read file.
Options:
  -h / --help: Display this help.
  -r <file> / --input <file>: Input sequence file. (required)
  -i <file1> <file2> / --interleave <file1> <file2>: Interleave two sequence
     files with the same number of sequences. May be used instead of a single
     input file.
  -q <file> / --quality <file>: Specify separate input quality file.
  -s <file> / --singleoutput <file>: Output fasta or fastq file for single
     reads.
  -t <file> / --singleadapteroutput <file> : Output fasta or fastq file for single
     reads where the adapter was found (for paired input, the adapter could be in
     the other read of the pair).
  -u <file> / --singlenonadapteroutput <file> : Output fasta or fastq file for
     single reads where the adapter was not found (for paired input, the adapter
     is not in any of the two reads).
  -p <file> / --pairedoutput <file>: Output fasta or fastq file for paired
     reads. Using this option means that the input is paired.
  -f <file> / --pairedadapteroutput <file>: Output fasta or fastq file for paired
     reads where the adapter was found in at least one of the reads. Using this
     option means that the input is paired.
  -g <file> / --pairednonadapteroutput <file>: Output fasta or fastq file for
     paired reads where the adapter was not found in any of the two reads. Using
     this option means that the input is paired.
  -e <mode> / --mode <mode>: Specify the actions taken:
       start: Keep the start of the read. (default)
       end: Keep the end of the read.
  -a <seq> / --adapter <seq>: Set the adapter sequence for both odd and even
     numbered reads. This option may be used several times for more than one
     adapter (default is the 454 FLX paired end adapter:
     GTTGGAACCGAAAGGGTTTGAATTCAAACCCTTTCGGTTCCAAC).
  -j <seq> / --adapter1 <seq>: Set the adapter sequence for odd numbered reads.
  -k <seq> / --adapter2 <seq>: Set the adapter sequence for even numbered reads.
  -d <set> / --predefinedadapter <set>: Use a predifeined adapter set. Use 'ti'
     for 454 Titanium and 'flx' for 454 FLX (flx is default)
  -m <n> / --minlength <n>: Set the minimum sequence length to output (default
     is 15)
  -c <n> / --cutoff <n>: Set the cutoff score used to determine if a read did
     actually contain an adapter. Use a lower value to increase the sensitivity
     and a higher value to increase specificity (integer, default is 10)
Example:
  Remove all the read sequence after the adapter sequence TATTTAGTGGCCGCG:
    clc_adapter_trim -r -i reads1.fq reads2.fq -p paired.fq -s single.fq
                                                              -a TATTTAGTGGCCGCG
  Remove all the read sequence after the adapter sequence TATTTAGTGGCCGCG and
  output paired reads where the adapter sequence was found to one file and the
  remaining paired reads to another file. All single reads are output to a third
  file:
    clc_adapter_trim -r -i reads1.fq reads2.fq -f paired_adapter.fq
                         -g paired_nonadapter.fq -s single.fq -a TATTTAGTGGCCGCG
  Note that the input is paired data in two files that are interleaved. The
  output reads that still form pairs after the trimming are put in the file
  paired.fq while the reads that loose their mate are put in single.fq. For
  unpaired data, just omit the "-p" option.
Browse the manual

Options for clc_adapter_trim
