Import using copy/paste of text
If you have e.g.
a text file or a browser displaying a sequence in one of the formats
that can be imported by CLC Drug Discovery Workbench, there is a very easy way to
get this sequence into the Navigation Area:
Copy the text from the text file or browser |
Select a folder in the Navigation Area |
Paste (
)
This will create a new sequence based on the text copied. This operation is equivalent to saving the text in a text file and importing it into the CLC Drug Discovery Workbench.
If the sequence is not formatted, i.e. if you just have a text like this: "ATGACGAATAGGAGTTCTAGCTA" you can also paste this into the Navigation Area.
Note! Make sure you copy all the relevant text - otherwise CLC Drug Discovery Workbench might not be able to interpret the text.