Browse the manual

Introduction to CLC Main Workbench
- Contact information
- System requirements
- Licenses
- About CLC Workbenches
- When the program is installed: Getting started
  - Quick start
  - Import of example data
- Plugins
- Network configuration
- Latest improvements
User interface
- View Area
- Zoom and selection in View Area
- Toolbox and Status Bar
- Workspace
- List of shortcuts
Data management and search
- Navigation Area
- Customized attributes on data locations
- Filling in values
  - What happens when the sequence is copied to another data location?
  - Searching
- Local search
User preferences and settings
- General preferences
- Default view preferences
  - Number formatting in tables
  - Import and export Side Panel settings
- Data preferences
- Advanced preferences
  - Default data location
  - NCBI BLAST
- Export/import of preferences
  - The different options for export and import
- View settings for the Side Panel
  - Saving, removing and applying saved settings
Printing
- Selecting which part of the view to print
- Page setup
  - Header and footer
- Print preview
Import/export of data and graphics
- Standard import
- Data export
- Export graphics to files
- Export graph data points to a file
- Copy/paste view output
History log
- Element history
  - Sharing data with history
Batching and result handling
- Batch processing
- How to handle results of analyses
  - Table outputs
  - Batch log
- Working with tables
  - Filtering tables
Workflows
- Creating a workflow
- Distributing and installing workflows
- Executing a workflow
Viewing and editing sequences
- View sequence
- Circular DNA
  - Using split views to see details of the circular molecule
  - Mark molecule as circular and specify starting point
- Working with annotations
- Element information
- View as text
- Sequence Lists
Data download
- GenBank search
- UniProt (Swiss-Prot/TrEMBL) search
- Search for structures at NCBI
- Sequence web info
BLAST search
- Running BLAST searches
- Output from BLAST searches
- Local BLAST databases
- Manage BLAST databases
  - Migrating from a previous version of the Workbench
- Bioinformatics explained: BLAST
3D Molecule Viewer
- Importing molecule structure files
- Viewing molecular structures in 3D
  - Moving and rotating
- Customizing the visualization
  - Visualization styles and colors
  - Project settings
- Snapshots of the molecule visualization
- Sequences associated with the molecules
- Troubleshooting 3D graphics errors
- Updating old structure files
General sequence analyses
- Extract sequences
- Shuffle sequence
- Dot plots
  - Create dot plots
  - View dot plots
- Bioinformatics explained: Dot plots
  - Realization of dot plots
  - Examples and interpretations of dot plots
- Bioinformatics explained: Scoring matrices
  - Different scoring matrices
  - Use of scoring matrices
- Local complexity plot
- Sequence statistics
  - Bioinformatics explained: Protein statistics
- Join sequences
- Pattern Discovery
  - Pattern discovery search parameters
  - Pattern search output
- Motif Search
Nucleotide analyses
- Convert DNA to RNA
- Convert RNA to DNA
- Reverse complements of sequences
- Reverse sequence
- Translation of DNA or RNA to protein
  - Translate part of a nucleotide sequence
- Find open reading frames
  - Open reading frame parameters
Protein analyses
- Signal peptide prediction
  - Signal peptide prediction parameter settings
  - Signal peptide prediction output
- Bioinformatics explained: Prediction of signal peptides
- Protein charge
  - Modifying the layout
- Transmembrane helix prediction
- Antigenicity
  - Plot of antigenicity
  - Antigenicity graphs along sequence
- Hydrophobicity
  - Hydrophobicity plot
  - Hydrophobicity graphs along sequence
- Bioinformatics explained: Protein hydrophobicity
  - Hydrophobicity scales
- Pfam domain search
  - Pfam search parameters
  - Download and installation of additional Pfam databases
- Secondary structure prediction
- Protein report
  - Protein report output
- Reverse translation from protein into DNA
  - Reverse translation parameters
- Bioinformatics explained: Reverse translation
  - The Genetic Code
  - Solving the ambiguities of reverse translation
- Proteolytic cleavage detection
  - Proteolytic cleavage parameters
- Bioinformatics explained: Proteolytic cleavage
Primers
- Primer design - an introduction
  - General concept
  - Scoring primers
- Setting parameters for primers and probes
  - Primer Parameters
- Graphical display of primer information
  - Compact information mode
  - Detailed information mode
- Output from primer design
- Standard PCR
  - User input
  - Standard PCR output table
- Nested PCR
  - Nested PCR output table
- TaqMan
  - TaqMan output table
- Sequencing primers
  - Sequencing primers output table
- Alignment-based primer and probe design
- Analyze primer properties
- Find binding sites and create fragments
  - Binding parameters
  - Results - binding sites and fragments
- Order primers
Sequencing data analyses and Assembly
- Importing and viewing trace data
  - Scaling traces
  - Trace settings in the Side Panel
- Demultiplex reads
- Trim sequences
  - Trimming using the Trim tool
  - Manual trimming
- Assemble sequences
- Sort Sequences By Name
- Assemble sequences to reference
- Add sequences to an existing contig
- View and edit contigs
- Reassemble contig
- Secondary peak calling
Expression analysis
- Experimental design
- Transformation and normalization
- Quality control
- Statistical analysis - identifying differential expression
- Feature clustering
  - Hierarchical clustering of features
  - K-means/medoids clustering
- Annotation tests
  - Hypergeometric tests on annotations
  - Gene set enrichment analysis
- General plots
Cloning and cutting
- Molecular cloning
- Gateway cloning
- Restriction site analysis
  - Dynamic restriction sites
  - Restriction site analysis from the Toolbox
- Gel electrophoresis
- Restriction enzyme lists
  - Create enzyme list
  - View and modify enzyme list
Sequence alignment
- Create an alignment
- View alignments
- Bioinformatics explained: Sequence logo
  - Calculation of sequence logos
- Edit alignments
- Join alignments
  - How alignments are joined
- Pairwise comparison
- Bioinformatics explained: Multiple alignments
  - Use of multiple alignments
  - Constructing multiple alignments
Phylogenetic trees
- Phylogenetic tree features
- Create Trees
- Tree Settings
- Metadata and Phylogenetic Trees
RNA structure
- RNA secondary structure prediction
- View and edit secondary structures
- Evaluate structure hypothesis
  - Selecting sequences for evaluation
  - Probabilities
- Structure Scanning Plot
  - Selecting sequences for scanning
  - The structure scanning result
- Bioinformatics explained: RNA structure prediction by minimum free energy minimization
  - The algorithm
  - Structure elements and their energy contribution
Appendix
- Comparison of workbenches
- Graph preferences
- BLAST databases
- Proteolytic cleavage enzymes
- Restriction enzymes database configuration
- Technical information about modifying Gateway cloning sites
- IUPAC codes for amino acids
- IUPAC codes for nucleotides
- Formats for import and export
  - List of bioinformatic data formats
  - List of graphics data formats
- Microarray data formats
- Translation Tables
- Custom codon frequency tables
- Matrices for alignment calculation
Bibliography

Import using copy/paste of text

If you have e.g. a text file or a browser displaying a sequence in one of the formats that can be imported by CLC Main Workbench, there is a very easy way to get this sequence into the Navigation Area:

Copy the text from the text file or browser | Select a folder in the Navigation Area | Paste ()

This will create a new sequence based on the text copied. This operation is equivalent to saving the text in a text file and importing it into the CLC Main Workbench.

If the sequence is not formatted, i.e. if you just have a text like this: "ATGACGAATAGGAGTTCTAGCTA" you can also paste this into the Navigation Area.

Note! Make sure you copy all the relevant text - otherwise CLC Main Workbench might not be able to interpret the text.