Options for clc_split_reads

usage: clc_split_reads [options]
  Split the sequences in a file according to a linker sequence to produce a file
  with paired end sequences and one with unpaired sequences.
Options:
  -h / --help: Display this help
  -i <file> / --input <file>: Input sequence file (required)
  -q <file> / --quality <file>: Specify separate input quality file.
  -s <file> / --singleoutput <file>: Output fasta or fastq file for single reads
     required)
  -p <file> / --pairedoutput <file>: Output fasta or fastq file for paired reads
     required)
  -l <seq> / --linker <seq>: Set the linker sequence. Option may be used several
     times for more than one linker (default is the 454 FLX paired end linker:
     GTTGGAACCGAAAGGGTTTGAATTCAAACCCTTTCGGTTCCAAC)
  -d <set> / --predefinedlinker <set>: Use a predifeined linker set. Use 'ti'
     for 454 Titanium and 'flx' for 454 FLX (flx is default)
  -m <n> / --minlength <n>: Set the minimum sequence length to output (default
     is 15)
Browse the manual

Options for clc_split_reads
